The similar miRNAs have different missions in the dissimilar plant tissues

Evaluation of miRNAs Expression pattern in the different plant tissues was the purpose of the current study. To this end, we have used IR64, a rice variety, as a model. Small RNA extracted from shoot and root tissues of plant and high throughput deep sequencing was applied to compare expression pattern of miRNAs in the different tissues. Results revealed 344 and 374 precursor and mature miRNAs in shoot and 326 and 353 precursor and mature miRNAs in root tissues, respectively. TCGCTTGGTGCAGATCGGGAC was the frequent miRNA sequence in both tissues named miR168a. In this study there were some mature miRNAs that only expressed in one of the tissues. Furthermore, many of miRNAs have been expressed differentially in a tissue compared to other tissue. Our results indicated that miRNAs play essential roles in dissimilar tissues but their regulation were distinct in the different tissues. Target prediction and gene ontology analysis showed that genes that are regulated by these miRNAs are involved in plant organs growth and development. Therefore, results of high throughput deep sequencing revealed that although miRNAs could be ubiquitous but with their differentially expression in the different tissues could alter their specific roles.

کلیدواژه ها:

microRNA ، Expression profiling ، Next generation sequencing ، Gene ontology ، Target prediction