Detection of Streptococcus iniae by specific species primers

Objective: Streptococcosis is a major bacterial disease in some economically important species of fish including rainbow trout, tilapia, yellowtail and seabass. Although, the affected fishes clinically show similar signs. Various Gram positive cocci of different bacterial species are involved in the etiology of disease outbreaks. Therefore, validation of molecular procedures for the detection of fish streptococcosis is an essential tool particularly for better understanding the epizootiology of the disease in aquaculture industry and in determining appropriate preventive criteria to the disease occurrence. Method & Materials: Seventy nine strains of Gram positive non-motile cocci bacteria were isolated from diseased rainbow trout in Mazandaran and Charmohal va Bakhteyari during 2007 to 2008. The bacterial isolates were first phenotipically characterized using routine acteriological works. The bacterial DNA was then extracted from 24 hour culture on nutrient agar supplemented with 5% defibrinated sheep blood at 28◦C. lctO ( Lactat oxidase) was used as the target gene, and PCR amplification was used using orward (AAGGGGAAATCGCAAGTGCC) and reverse primers (ATATCTGATTGGGCCGTCTAA) for identification of S. iniae. Results & Conclusion: PCR analysis of the isolated bacteria showed that 24 (31.6%) of these bacterial isolates stretch of 870 bp which exhibit identical size to reference strains of S. iniae used as the positive control in this study. These strains were isolated from four trout farms of Mazandaran, Tehran, Gilan and Fars provinces.

کلیدواژه ها:

Key words: Streptococcosis ، Streptococcus iniae ، rainbow trout ، PCR